Home » Ciência » CRISPR - Entenda o que é e quais as possibilidades, sem hype ou histeria

CRISPR - Entenda o que é e quais as possibilidades, sem hype ou histeria

Muito se fala de CRISPR, a técnica de engenharia genética que vai salvar ou destruir o mundo, mas como esse negócio funciona? Vai mesmo mudar tudo assim? O quanto é hype e o quanto é histeria? Clique e descubra!

50 semanas atrás

Bactérias e Arqueas estão entre os organismos mais primitivos conhecidos pelo Homem. Não tanto quanto comentaristas de portal, mas quase. Essas criaturinhas unicelulares não possuem núcleo ou organelas individuais bem definidas, e para piorar ainda mais suas vidas são alvos de ataques implacáveis de vírus, mas eles não estão indefesos, não senhor. Tio Darwin deu a elas uma arma chamada CRISPR!


Quando um vírus invade uma bactéria ou uma célula, ele injeta seu DNA (ou RNA) e como são burros, os mecanismos de replicação da célula começam a reproduzir o DNA do vírus, que é decodificado, produzindo proteínas e, no final, a célula explode liberando milhares de cópias do vírus. Mas nem tudo está perdido, nosso primitivo organismo tem defesas, conseguidas com duras penas depois de muito evoluir.

Assim que o DNA do vírus entra na célula, uma família de proteínas chamadas Cas1 identificam o material genético invasor e recortam um pedaço dele, pegando o que seria uma "assinatura" do vírus. Essa assinatura é incorporada no DNA da célula invadida, que em seguida aciona uma enzima chamada Cas9. Ela carrega uma sequência de DNA com uma cópia do DNA do vírus.

Quando ela encontra o DNA viral e compara com a sequência em memória, se forem iguais ela irá cortar fisicamente o DNA do vírus, inutilizando-o.

Agora a beleza da coisa: como a sequência de bases nucleicas do DNA viral fica gravada no código genético da bactéria invadida, da próxima vez que outro vírus do mesmo tipo tentar atacar a célula, dará de cara com um monte de enzimas Cas9 armadas e engatilhadas prontas para cortar seu barato.

O processo já foi inclusive observado em vídeo, fruto de uma pesquisa da Universidade Kanazawa e da Universidade de Tóquio.

O termo CRISPR (clustered regularly interspaced short palindromic repeats) apareceu pela primeira vez em 2001, em um paper de Francisco Mojica e Ruud Jansen, mas a primeira observação da coisa foi feita em 1987 por Yoshizumi Ishino, da Universidade de Osaka.

Ele estava estudando um gene chamado iap, ligado a morte celular, quando reparou que em várias partes do genoma da bactéria E.Coli, apareciam sequências repetidas e palindrômicas em blocos pequenos. Elas eram chamadas palindrômicas porque podiam ser lidas da mesma forma em ambas as direções, como a clássica frase: "Socorram-me subi no ônibus em Marrocos"

Assim uma sequência dessas poderia ser:

AGTTCAAGTCACAACACTGAACTTGA

Essas sequências palindrômicas eram separadas por sequências de DNA que foram chamadas de espaçadores, e em 1993 foi detectada a replicação desses espaçadores dentro dos organismos.

Em 2001 Mojica e Jansen estavam pesquisando a função das sequências palindrômicas e espaçadores, e graças a um software escrito por um aluno de Mojica, encontraram sequências palindrômicas em 20 espécies de micro-organismos.

Mais adiante Jansen descobriu que sempre que havia uma sequência de espaçadores e palíndromos, ela era antecedida por genes de proteínas cas. Em seguida um preâmbulo, e então começaram a sequência de palíndromos, com 28 a 37 bases nucleicas, e entre eles os espaçadores, com 32 a 38 bases.

Em 2005 Mojica e outros colegas publicaram um paper de título  "Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements". Eles descreveram como identificaram nos espaçadores do DNA das bactérias sequências genéticas presentes em vírus bacteriófagos. Estava evidente de que havia uma relação entre CRISPR e um sistema imunológico das bactérias. Mais alguns anos de pesquisa e o modelo todo foi desvendado.

É em essência algo incrivelmente simples de entender: o mecanismo de defesa da bactéria guarda pedaços do DNA de vírus malignos, produz uma enzima chamada Cas9 que carrega uma sequência de RNA baseada no DNA maligno. A enzima escaneia toda molécula de DNA que encontra. Se acha uma sequência que combina com a que tem armazenada, aciona uma tesoura molecular que literalmente corta ao meio a molécula, naquele exato e preciso ponto.

Bingo!

Até então as técnicas CRISPR eram um pouco mais complicadas do que eu descrevi, na verdade a cas9 precisa de duas moléculas de RNA, uma que faz a identificação do DNA-alvo, e outra que contém o padrão a ser identificado. Aí em 2012 tudo mudou graças a essas duas moças:

Elas são Jennifer Doudna e Emmanuelle Charpentier. Manu é bioquímica, microbióloga e geneticista. Estudou na Universidade Pierre e Marie Curie, no Instituto Pasteur e fez pós-doutorado na Universidade Rockefeller nos EUA. Hoje ela é diretora do Instituto Max Planck na Alemanha.

A loura é a Doudna, americana bioquímica com pós-doutorado na Universidade de Boulder, Colorado. Juntas elas revolucionaram a genética molecular quando conseguiram unificar as duas sequências de RNA da cas9, simplificando extremamente um processo que já era bem mais simples que os métodos tradicionais de manipulação genética.

Cut... and Paste!

Células têm mecanismos de reparo quando DNA é danificado, elas tentam reconectar as partes cortadas, mas se uma sequência de bases foi removida, o resultado é um gene com defeito, não-funcional.

Entretanto é possível usar CRISPR para cortar um pedaço específico de DNA, e ao mesmo tempo você satura a área com templates de reparo, sequências curtas de DNA que se encaixam nas pontas das partes removidas. Os mecanismos de reparo da célula preferem essas partes, e vão colá-las no lugar do pedaço removido.

CRISPR pode ser usado para desativar genes específicos e até cromossomos inteiros, é possível usar versões da cas9 com a tesoura molecular desativada, então ela encontra a sequência específica, se prende naquele lugar e interfere com o processo da célula de ler aquela informação. Para todos os efeitos o gene está desativado, sem que o DNA seja danificado.

As Aplicações

Anemia Falciforme é uma doença muito cruel, que afeta 2% das crianças nascidas na África subsaariana, região que concentra dois terços dos portadores. É uma condição genética incurável que mata 150 mil pessoas por ano e prejudica a qualidade de vida de todo mundo que sobrevive. Ela é causada por uma molécula de hemoglobina defeituosa, culpa de uma β-globina capenga.

Essa β-globina defeituosa é especificada no cromossomo 11 e o defeito é uma única base nucleica, que originalmente deveria ser GAG (guanina adenina guanina) mas por uma mutação virou GTG (guanina timina guanina).

Com CRISPR seria trivial consertar essa falha em um espermatozoide, óvulo ou mesmo um embrião.

XY, é um menino, ao menos até descobrir o Tumblr.

Indo além, se podemos desabilitar um cromossomo inteiro, isso seria uma cura completa para doenças como Síndrome de Down. Talvez seja possível até fazer isso com o organismo já formado, mas ninguém sabe como um ser vivo reagiria a uma mudança dessas.

CRISPR está sendo estudada como alternativa para fibrose cística, esclerose múltipla e uma penca de outras doenças sérias de origem genética, mas não pára aí.

Podemos imunizar organismos úteis, como as que usamos para profundir cerveja ou insulina (primeiro os da cerveja, please). Podemos remover retrovírus e genes que causam rejeição de órgãos transplantados.

O que já conseguimos

A técnica está sendo usada em organismos unicelulares e até em espécies mais complexas. Cientistas chineses usaram CRISPR para desativar o cromossomo Y em zigotos de ratos, que foram transplantados para ratas de aluguel, e se desenvolveram em lindas ratinhas. Isso mesmo, mudaram o sexo do bicho.

Eles também testaram células-tronco humanas com Down, desativando o cromossoma 21 extra.

Leitões sofrem muito com duas doenças virais, gastroenterite (causada pelo vírus TGEV) e diarreia, causada pelo PEDV. Essas doenças causam um prejuízo anual de US$600 milhões aos criadores americanos.

Randall Prather, da Universidade do Missouri e Bob Rowland, da Kansas State University, descobriram que o trabalho dos vírus era facilitado por uma proteína chamada ANPEP. Eles identificaram o gene que expressa essa proteína, programaram sua localização no CRISPR e modificaram embriões para que os futuros porquinhos não mais produzissem a tal proteína.

As ninhadas nascera e os porcos foram contaminados com os dois vírus. Eles ainda sofreram de diarreia, mas não tinham nem sinal da gastroenterite e o TGEV não foi detectado nas fezes. Fora isso os porquinhos estavam lindos felizes e perfeitamente normais, ao menos até serem sacrificados para uma necropsia detalhada. Yay Science!

A pesquisa foi publicada no paper Resistance to coronavirus infection in amino peptidase N-deficient pigs.

A lista de experimentos envolvendo CRISPR é imensa e promissora, mas a grande surpresa aconteceu por esses dias, quando cientistas chineses liderados por He Jiankui, da Southern University of Science and Technology, em Shenzhen, anunciaram que usaram CRISPR para editar o DNA de duas meninas, gêmeas chamadas Lulu e Nana.

Segundo eles a modificação foi copiar uma mutação bem rara chamada CCR5-Δ32.  As poucas pessoas que têm essa mutação são imunes ao HIV. Isso foi descoberto quando o sujeito mais azarado do mundo se tornou o mais sortudo. O coitado já tinha AIDS, e para piorar desenvolveu leucemia. Depois da quimio, precisou de um transplante de medula para recuperar o sistema imunológico, que não funcionaria muito bem, because AIDS.

Só que o doador tinha a mutação CCR5-Δ32. A carga viral do sujeito começou a cair, depois de 600 dias atingiu níveis indetectáveis. Ele foi acompanhado por mais seis anos, ao final dos quais foi declarado curado, HIV-Negativo e agora as únicas preocupações dele são gonorreia e pensão alimentícia.

E quais os problemas?

É muito mais complicado usar CRISPR em organismos complexos. Nós somos ótimos em evitar que coisas indesejadas entrem em nossas células, o irônico é que a técnica mais eficiente para invadir uma célula humana e despejar a cas9, o RNA com o padrão e os templates de reparo é usando... um vírus. Isso causa uma resposta desbalanceada, e o sistema imunológico não gosta de vírus.

Esse, aliás, é o grande problema: as moléculas usadas no CRISPR são kibadas de organismos como o Staphylococcus aureus e o Streptococcus pyogenes, e nosso sistema imunológico detesta esses caras. Quando sente o cheiro, aciona linfócitos pra matar esmagar, destruir e nisso matam as células junto, numa taxa de 80%.

Em um estudo publicado na Nature, 79% dos humanos testados apresentaram anticorpos contra a cas9 do Staphylococcus aureus, e 65% contra a da Streptococcus pyogenes.

Streptococcus pyogenes

Há pesquisas que conseguiram alterar as enzimas a ponto de não gerarem resposta imunológica, mas não se sabe o quanto isso afeta sua eficiência, e aí caímos no outro problema:

CRISPR às vezes não funciona. Como tudo em biologia, nada é perfeito. Um paper publicado na Nature, escrito por Michael Kosicki, Kärt Tomberg e Allan Bradley, intitulado Repair of double-strand breaks induced by CrIsPr–Cas9 leads to large deletions and complex rearrangementsalerta para danos extensos no genoma, com deleção em alguns casos de milhares de bases.

Aparentemente o mecanismo de correção nas células não faz milagres e nem sempre pega o template de inserção correto, cola de qualquer jeito o DNA e o resultado é um trabalho porco. E câncer, claro. Essas coisas sempre resultam em câncer.

As próprias criadoras da técnica, Jennifer Doudna e Emmanuelle Charpentier estão pedindo uma moratória em pesquisas envolvendo humanos. Dizem que é muito cedo, sabemos muito pouco ainda sobre os detalhes e consequências do CRISPR, técnicas que afetem a estrutura genética de organismos, e consequentemente sejam repassadas para a prole, devem ser tratadas com o máximo de cuidado e temeridade.

Considerações Éticas

Essas são as preferidas dos filósofos e palpiteiros, se me permite o pleonasmo. Dizem que o Homem não pode brincar de Deus, mas vou contar um segredo: o Homem já brinca de Deus desde 1767, quando a Sociedade Para Recuperação de Pessoas Afogadas foi fundada na Holanda e criou os primórdios da Reanimação Cardiopulmonar, embora eu reconheça que estimular o afogado com fumaça de tabaco no ânus não seja mais prática tão comum.

Em quatro ânus, digo anos, eles salvaram 150 pessoas, pelo simples fato de não aceitaram a morte como inevitável.

Quando Louise Brown foi apresentada ao mundo em 1978, a reação foi extremamente variada e extremamente radical.

Fruto da primeira fertilização in-vitro bem-sucedida, Louise era vista por uns como um milagre da ciência, mas outros a achavam uma abominação, cientistas hereges estariam desafiando Deus determinando a eles o momento da concepção. O Vaticano protestou e houve até gente dizendo que Louise não teria alma, por ter sido concebida à revelia de Deus.

Hoje em dia bebê de proveta é algo tão comum, tão mundano que as pessoas nem comentam mais se são fruto de fertilização in-vitro, é algo que tem zero estigma social.

Os argumentos de que CRISPR pode gerar uma série de "bebês projetados" também não colam. Os pais vão escolher que querem bebês mais inteligentes, com menos predisposição a doenças, e qual o problema? Será que escolherem a cor dos olhos é um preço tão alto para ninguém mais nascer com uma bomba-relógio em seus genes, aguardando a hora de desencadear Huntington, esclerose múltipla, Alzheimer ou vegetarianismo?

Hoje já fazemos seleção genética de embriões para fertilização in-vitro, e mesmo durante a gravidez, através de análise do líquido amniótico. Quem pode já escolhe até o sexo do bebê.

A idéia de que CRISPR criará uma raça de mutantes, o homo superior, enquanto o resto do mundo permanecerá na obscuridade é uma bobagem. Ciência não funciona assim, as tecnologias se aprimoram e se barateiam. Aquele Raio-X que qualquer dentista de subúrbio tem era algo restrito a gente muito rica no começo do século 20. Fertilização in-vitro? No Brasil custa R$11 mil, ou você pode fazer pelo SUS. E se você acha que é algo ainda assim restrito, até em Uganda fazem fertilização in vitro.

Se o CRISPR se tornar a técnica que todos esperamos, acontecerá o de sempre: inicialmente os tratamentos serão caros, com o tempo se tornarão mais em conta e no final você comprará em farmácia. Nos Anos 80 o Fantástico anunciou a Cura do Câncer (ok eles anunciam toda semana), o Interferon, uma droga mágica que custava milhões.

Não era a cura definitiva, mas se mostrou um excelente antiviral, usado para doenças como hepatite, controle de tumores e viroses de verdade, daquelas que nada mais adianta. Quanto custa? R$256,00.

Conclusão

CRISPR pode salvar o mundo, mas se o fizer não será hoje. CRISPR é uma ferramenta que nos permite encontrar imediatamente um trecho em qualquer livro de uma biblioteca, mas estão todos escritos em um idioma que quase não entendemos. CRISPR é a técnica mais promissora para controlarmos o destino genético da vida na Terra, mas também pode ser que fique restrito a casos específicos, talvez a complexidade de lidar com organismos inteiros seja grande demais.

A única certeza é que nem tão cedo teremos super-bebês, nem infelizmente a cura de um monte de doenças. A ciência responsável não se precipita, já tivemos erros demais, como a Talidomida. No máximo CRISPR só será boa notícia a curto prazo se você for um porco, e não tiver ouvido falar em feijoada.

Leia mais sobre: , .

relacionados


Comentários