Home » Ciência » Microsoft e Universidade de Washington criam primeiro sistema automatizado de armazenamento de dados em DNA

Microsoft e Universidade de Washington criam primeiro sistema automatizado de armazenamento de dados em DNA

34 semanas atrás

Em Star Trek: Voyager os computadores da nave eram suplementados por bolsas de biogel, contendo células neurais e processando informação muito mais rápido que os chips isolineares convencionais. A ideia de usar DNA como mecanismo de armazenamento de dados, entretanto é bem mais antiga.

O conceito foi apresentado formalmente em um trabalho científico em 1965 por Mikhail Neiman, baseado em uma conversa com o igualmente cientista Norbert Wiener um ano antes, o que é uma ideia bem avançada, levando-se em conta que a estrutura do DNA só foi descoberta em 1953.

Mesmo assim, entre querer e fazer há uma grande distância, e só conseguimos usar DNA para armazenamento de informação, de forma rudimentar, em 2012, quando cientistas de Harvard codificaram em filamentos de DNA um livro de 53.400 palavras, com imagens em jpeg e um programa em Javascript.

Que Diabos É DNA?

A rigor seria ADN, Ácido Desoxirribonucleico, mas ninguém usa a sigla em português. Em essência DNA é muito mais do que gel de cabelo, ingrediente culinário ou a forma mais eficiente de nunca mais dormir direito e arruinar suas finanças por pelo menos 25 anos. DNA é uma molécula responsável por tudo isso que está aí.

Toda a vida na Terra, da mais humilde bactéria comentarista de portal a Stephen Hawking, das baleias jubarte aos formigueiros, dos tardígrados aos elefantes, existem para perpetuar o DNA, uma molécula que bilhões de anos atrás descobriu como replicar a si mesma.

A molécula de DNA é composta de uma hélice dupla, como se fosse uma escada espiral. Os corrimões são feitos de fosfatos e açúcares, e os degraus são formados por bases nitrogenadas, quatro pra ser preciso: adenina, guanina, citosina e timina. Juntas elas formam AGCT, as quatro letras usadas para escrever a vida.

Todas as proteínas que compõe um ser vivo, toda a receita para construir um sapo ou a Luciana Vendramini está codificada no DNA, em pares de Adenina-Tiamina e Citosina-Gianina. A Música da Vida tem duas notas, AT e GC. Por exemplo: O começo do gene Sonic Hedgehog (sim, é esse o nome) que regula a estrutura fundamental do embrião no começo da divisão celular é:

TGAAGCCTGGAGTGGGGTCCCGAGCCGCTACACTAAATAGATTTAATGTGCGCTCTGGGGCCGCCAGGAAAGACGCTCAGGCCTCGCTAGGAGCATCGGCTGTTTCAGGACCTGGAGAAAGGCCCCCAGCTCTACCCTGAGAGGACGTGCTCCTCCACGCTCCTCCGCAAATGCTGTCCCTCTTCCCCAGCCCAGGGCCCGGCTCTTCGA
GGTGTAAGGACAAGTTGAACGCTTTGGCCATCTCGGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGGACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCAGTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGCCCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGGCACATATCCACTGCTCGGTGAAAGCAGGCAAGGAAAGGAAACCACTGCTTAGAGACACTAGGTACAGGGCATCAAGAGGGTGCAGCCCAGCCCCGCCAGGACGAGGCGCCGACTTCTCATTCAGGGTTGACGGAGCCAAGAGTTTGTGCAAAATGTATGCATGGTGGTTGCTGCCAGCCTCCCTCATGACTAAATGCATATCTATTCCTGTCAAAACGTGTATCACAATGTACTTGAAACTGTTATCTTTGTGCTCTATTGTTTGAATAATTAAAGAAATTACAGAGAC

Em teoria você pode pegar uma máquina de sintetização de DNA e escrever suas próprias sequências, os painéis dos modelos antigos tem até as quatro bases:

Se convertermos os pares AT/GC para 0 e 1, transformando-os em informação binária, a quantidade de dados presentes em uma célula normal equivale a 1,5 GB de informação. Sim, é muito pouco, mas o suficiente para criar... você. A não ser que este texto esteja sendo lido no futuro pelos nossos Lordes Robóticos, então podem rir à vontade.

Por curiosidade, as células sexuais (óvulos e espermatozoides) possuem metade da informação genética de uma célula comum, 750 MB. Durante uma ejaculação são emitidos espermatozoides num total de 135 mil Terabytes de dados, mas caso haja fecundação somente 750 MB acabam utilizados. É uma relação conteúdo/lixo quase tão ruim quanto o catálogo de e-books gratuitos da Amazon.

Uma grande vantagem do DNA é que ele ocupa pouco espaço. É uma molécula e, portanto, quase unidimensional. Esticado todo o DNA de uma célula humana, atinge uns dois metros de comprimento, mas ele é tão fino que forma um novelo no núcleo da célula.

A palavra-chave aqui é... Densidade.

Um HD comum tem uma densidade de dados de 1013 bits por cm3. Ou seja, 1 seguido de treze zeros, ou 10000000000000 bits. Já uma molécula de DNA armazena dados com 1019 bits por cm3. 10000000000000000000. Comparemos os dois números:

10000000000000
10000000000000000000

Exato, um milhão de vezes mais dados no mesmo espaço. Isso significa que todos os filmes já produzidos cabem em um cubo de DNA do tamanho de um torrão de açúcar.

Todo o conhecimento criado pelo Homem, desde a aurora dos tempos, todas nossas obras de arte, histórias, filmes, canções, teorias científicas, documentários, tweets e comentários de portal caberiam em um cubo de DNA de 1 kg de peso.

Em 2013 foram feitos experimentos de codificação de dados em DNA, com um monte de técnicas e algoritmos de correção de erros, incluindo repetir quatro vezes a mesma sequência, duas delas detrás pra frente. Foram codificados 5 MB, com taxa de sucesso entre 99,99% e 100%, mas aí vem a facada. Cada MB armazenado custou US$ 12.400. LER esses dados custa US$ 220 por MB.

Cientistas da Columbia University em 2017 conseguiram armazenar dados em DNA a uma densidade de 215 petabytes por grama. Em HDs de 10 Terabytes isso equivale a 21.500 HDs. Com um peso de 650 gramas por HD, isso daria 13.975 toneladas.

Nesses experimentos eles baixaram o custo de escrita para US$ 3.500 por MB e leitura para US$ 1.000, mas esse não é o problema principal a ser resolvido ainda. Hoje um sequenciador de DNA topo de linha leva 30 horas para sequenciar DNA equivalente a 120 Gb. Que o equipamento pra isso custa US$ 347 mil também é só um detalhe.

O trabalho ainda é essencialmente manual, mas se quisermos no futuro usar DNA como tecnologia de armazenamento de dados, é preciso automatizar o processo, e o primeiro grande passo foi dado com uma pesquisa da Microsoft Research e da Universidade de Washington.

Eles criaram uma prova de conceito, um equipamento que, acoplado a um computador, consegue fazer todo o trabalho de gravar dados em uma sequência de DNA e depois ler essa sequência, com um mínimo de intervenção manual.

Não se engane, é um equipamento extremamente primitivo, os sequenciadores de DNA estão para um SSD como os primeiros teares com cartões perfurados estão para um laptop Surface.

Esse equipamento novo é um tear aonde ao invés de crianças girando a roda, estão usando uma roda d'água, é uma tecnologia que ainda está décadas atrás do tempo em que será prática, mas é preciso começar, e estamos começando e avançando.

Estamos testemunhando o começo de outra revolução tecnológica, mas essa vai ser mais demorada e muito mais complicada. Por outro lado, suprirá nossas necessidades por algumas centenas de anos, até alguém resolver lançar Pr0n Holográfico em 5D e 64K.

Leia mais sobre: , , .

relacionados


Comentários